mouse p52 Search Results


92
OriGene p44 interacting protein
(A) and (B) Interaction among AR, Smad1 and <t>p44</t> in androgen-dependent manner by yeast two-hybrid assay. Different combinations among AR, Smad1 and p44 were tested and p44 interaction with full length Smad1 mediated by AR in androgen-dependent manner. (C) Physical interaction among AR, Smad1 and p44 confirmed by co-immunoprecipitation assay. Left , with anti-p44 immunoprecipitation, AR was detectable in the presence of androgen; Middle , with anti-Smad1 immunoprecipitation, p44 was in complex with Smad1 in the presence of androgen; Right , with anti-Smad1 immunoprecipitation,AR was present in the complex with Smad1 regardless of androgen. (D) ChIP analysis showed that AR, p44 and Smad1 were recruited to the p21 promoter in the presence of androgen and BMP-2.
P44 Interacting Protein, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+p52/pmc03667176-48-3-27?v=OriGene
Average 92 stars, based on 1 article reviews
p44 interacting protein - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

90
Advanced Biotechnologies Inc mouse mabs against p52 (ul44)
(A) and (B) Interaction among AR, Smad1 and <t>p44</t> in androgen-dependent manner by yeast two-hybrid assay. Different combinations among AR, Smad1 and p44 were tested and p44 interaction with full length Smad1 mediated by AR in androgen-dependent manner. (C) Physical interaction among AR, Smad1 and p44 confirmed by co-immunoprecipitation assay. Left , with anti-p44 immunoprecipitation, AR was detectable in the presence of androgen; Middle , with anti-Smad1 immunoprecipitation, p44 was in complex with Smad1 in the presence of androgen; Right , with anti-Smad1 immunoprecipitation,AR was present in the complex with Smad1 regardless of androgen. (D) ChIP analysis showed that AR, p44 and Smad1 were recruited to the p21 promoter in the presence of androgen and BMP-2.
Mouse Mabs Against P52 (Ul44), supplied by Advanced Biotechnologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+p52/10__1128_slash_jvi__00411___09-118-0-11?v=Advanced+Biotechnologies+Inc
Average 90 stars, based on 1 article reviews
mouse mabs against p52 (ul44) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
OriGene technologiesr ctgtgagcaaggactttcccag nfkb2 a subunit
(A) and (B) Interaction among AR, Smad1 and <t>p44</t> in androgen-dependent manner by yeast two-hybrid assay. Different combinations among AR, Smad1 and p44 were tested and p44 interaction with full length Smad1 mediated by AR in androgen-dependent manner. (C) Physical interaction among AR, Smad1 and p44 confirmed by co-immunoprecipitation assay. Left , with anti-p44 immunoprecipitation, AR was detectable in the presence of androgen; Middle , with anti-Smad1 immunoprecipitation, p44 was in complex with Smad1 in the presence of androgen; Right , with anti-Smad1 immunoprecipitation,AR was present in the complex with Smad1 regardless of androgen. (D) ChIP analysis showed that AR, p44 and Smad1 were recruited to the p21 promoter in the presence of androgen and BMP-2.
Technologiesr Ctgtgagcaaggactttcccag Nfkb2 A Subunit, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+p52/10__3920_slash_bm2012__0027-268-241-240?v=OriGene
Average 90 stars, based on 1 article reviews
technologiesr ctgtgagcaaggactttcccag nfkb2 a subunit - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Merck KGaA mouse anti-p52
(A) and (B) Interaction among AR, Smad1 and <t>p44</t> in androgen-dependent manner by yeast two-hybrid assay. Different combinations among AR, Smad1 and p44 were tested and p44 interaction with full length Smad1 mediated by AR in androgen-dependent manner. (C) Physical interaction among AR, Smad1 and p44 confirmed by co-immunoprecipitation assay. Left , with anti-p44 immunoprecipitation, AR was detectable in the presence of androgen; Middle , with anti-Smad1 immunoprecipitation, p44 was in complex with Smad1 in the presence of androgen; Right , with anti-Smad1 immunoprecipitation,AR was present in the complex with Smad1 regardless of androgen. (D) ChIP analysis showed that AR, p44 and Smad1 were recruited to the p21 promoter in the presence of androgen and BMP-2.
Mouse Anti P52, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+p52/pm32170726-327-44-46?v=Merck+KGaA
Average 90 stars, based on 1 article reviews
mouse anti-p52 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

N/A
26S Proteasome p52 subunit mouse monoclonal antibody clone p52 26S 17 Supernatant
  Buy from Supplier

Image Search Results


(A) and (B) Interaction among AR, Smad1 and p44 in androgen-dependent manner by yeast two-hybrid assay. Different combinations among AR, Smad1 and p44 were tested and p44 interaction with full length Smad1 mediated by AR in androgen-dependent manner. (C) Physical interaction among AR, Smad1 and p44 confirmed by co-immunoprecipitation assay. Left , with anti-p44 immunoprecipitation, AR was detectable in the presence of androgen; Middle , with anti-Smad1 immunoprecipitation, p44 was in complex with Smad1 in the presence of androgen; Right , with anti-Smad1 immunoprecipitation,AR was present in the complex with Smad1 regardless of androgen. (D) ChIP analysis showed that AR, p44 and Smad1 were recruited to the p21 promoter in the presence of androgen and BMP-2.

Journal: PLoS ONE

Article Title: Functional Domains of Androgen Receptor Coactivator p44/Mep50/WDR77and Its Interaction with Smad1

doi: 10.1371/journal.pone.0064663

Figure Lengend Snippet: (A) and (B) Interaction among AR, Smad1 and p44 in androgen-dependent manner by yeast two-hybrid assay. Different combinations among AR, Smad1 and p44 were tested and p44 interaction with full length Smad1 mediated by AR in androgen-dependent manner. (C) Physical interaction among AR, Smad1 and p44 confirmed by co-immunoprecipitation assay. Left , with anti-p44 immunoprecipitation, AR was detectable in the presence of androgen; Middle , with anti-Smad1 immunoprecipitation, p44 was in complex with Smad1 in the presence of androgen; Right , with anti-Smad1 immunoprecipitation,AR was present in the complex with Smad1 regardless of androgen. (D) ChIP analysis showed that AR, p44 and Smad1 were recruited to the p21 promoter in the presence of androgen and BMP-2.

Article Snippet: Briefly, to screen p44 interacting protein, yeast strain EGY48 ( MATa leu2::6xLexAop-LEU2 trp ura ade his ) was transformed with pSH18-34 reporter vector [URA3, 2 μ, 8xLexAop::lacZ] (Origene Technologies), pLexA or pLexA::p44.

Techniques: Y2H Assay, Co-Immunoprecipitation Assay, Immunoprecipitation

(A), (B) and (C) Schematics of construction of yeast two-hybrid plasmids for p44, Smad1 and AR. (D) The extreme N-terminus (N2, p44, AA1-70) was able to sustain reporter expression in yeast two-hybrid reporter assay (p = 0.017). (E) Only the full length Smad1 is able to interact with AR and p44 (p = 0.038). (F) The NTD domain of AR was able to drive the expression of the reporter gene in the presence of androgen with full length Smad1 and p44 (p = 0.034). (G) Luciferase assay also revealed that N-terminus (N8, p44 AA1-266) mediates maximal AR transcriptional activation (p = 0.041).

Journal: PLoS ONE

Article Title: Functional Domains of Androgen Receptor Coactivator p44/Mep50/WDR77and Its Interaction with Smad1

doi: 10.1371/journal.pone.0064663

Figure Lengend Snippet: (A), (B) and (C) Schematics of construction of yeast two-hybrid plasmids for p44, Smad1 and AR. (D) The extreme N-terminus (N2, p44, AA1-70) was able to sustain reporter expression in yeast two-hybrid reporter assay (p = 0.017). (E) Only the full length Smad1 is able to interact with AR and p44 (p = 0.038). (F) The NTD domain of AR was able to drive the expression of the reporter gene in the presence of androgen with full length Smad1 and p44 (p = 0.034). (G) Luciferase assay also revealed that N-terminus (N8, p44 AA1-266) mediates maximal AR transcriptional activation (p = 0.041).

Article Snippet: Briefly, to screen p44 interacting protein, yeast strain EGY48 ( MATa leu2::6xLexAop-LEU2 trp ura ade his ) was transformed with pSH18-34 reporter vector [URA3, 2 μ, 8xLexAop::lacZ] (Origene Technologies), pLexA or pLexA::p44.

Techniques: Expressing, Reporter Assay, Luciferase, Activation Assay

( A ) Schematics of construction of luciferase reporters with androgen response element (ARE) or Smad1 response element (SRE). (B) Individual Smad1, Smad4 and p44 only showed basal level of transcription activation from the synthetic Smad reporter in the presence of BMP-2. Co-transfection of Smad1 and Smad4 dramatically increases the Smad-dependent transcription activation increase. p44 did not have any effect on Smad1/Smad4-dependent activation of the reporter. (C) Smad1 acts as a corepressor on p44-dependent stimulation of AR-dependent transcription activation (p = 0.04 in luciferase assay). (D) Both p44 and Smad1 increase transcription activation of the reporter with p21 promoter in the presence of both R1881 and BMP-2. (E) and (F) The interplay of p44 and Smad1/Smad4 on transcription activation with reporter containing p21 promoter and reporter containing synthetic ARE and SRE. Smad1 alone had an inhibitory effect on p44-activated transcription at low doses of p44 and this inhibitory effect disappeared in the presence of Smad4 (p<0.05). (G) Models of interplay among AR, p44 and Smad1 on transcription activation.

Journal: PLoS ONE

Article Title: Functional Domains of Androgen Receptor Coactivator p44/Mep50/WDR77and Its Interaction with Smad1

doi: 10.1371/journal.pone.0064663

Figure Lengend Snippet: ( A ) Schematics of construction of luciferase reporters with androgen response element (ARE) or Smad1 response element (SRE). (B) Individual Smad1, Smad4 and p44 only showed basal level of transcription activation from the synthetic Smad reporter in the presence of BMP-2. Co-transfection of Smad1 and Smad4 dramatically increases the Smad-dependent transcription activation increase. p44 did not have any effect on Smad1/Smad4-dependent activation of the reporter. (C) Smad1 acts as a corepressor on p44-dependent stimulation of AR-dependent transcription activation (p = 0.04 in luciferase assay). (D) Both p44 and Smad1 increase transcription activation of the reporter with p21 promoter in the presence of both R1881 and BMP-2. (E) and (F) The interplay of p44 and Smad1/Smad4 on transcription activation with reporter containing p21 promoter and reporter containing synthetic ARE and SRE. Smad1 alone had an inhibitory effect on p44-activated transcription at low doses of p44 and this inhibitory effect disappeared in the presence of Smad4 (p<0.05). (G) Models of interplay among AR, p44 and Smad1 on transcription activation.

Article Snippet: Briefly, to screen p44 interacting protein, yeast strain EGY48 ( MATa leu2::6xLexAop-LEU2 trp ura ade his ) was transformed with pSH18-34 reporter vector [URA3, 2 μ, 8xLexAop::lacZ] (Origene Technologies), pLexA or pLexA::p44.

Techniques: Luciferase, Activation Assay, Cotransfection

(A) Upper panel: Proliferation of cells stably expressing truncated N-terminal p44 in LNCaP cells. Truncated NLS-N8 showed significantly inhibitory effects on cell proliferation in LNCaP cells (p = 0.02). Lower panel: RT-PCR for expression of truncated constructs. (B) Upper panel: Proliferation of cells stably expressing truncated C-terminal p44 in LNCaP cells. Truncated NLS-C8 and NLS-C6 (p<0.05) displayed inhibitory effects on cell proliferation in LNCaP cells. Lower panel: RT-PCR for expression of truncated constructs. (C) Upper panel: Proliferation of cells stably expressing truncated N-terminal p44 in LNCaP-AI cells. Truncated NLS-N8 and NLS-N6 (p = 0.04) showed significant inhibitory effects on cell proliferation in LNCaP-AI cells. Lower panel: RT-PCR for expression of truncated constructs. (D) Upper panel: Proliferation of cells stably expressing truncated C-terminal p44 in LNCaP-AI cells. Truncated NLS-C8 and NLS-C6 (p = 0.035) displayed significant inhibitory effects on cell proliferation in LNCaP cells. Lower panel: RT-PCR for expression of truncated constructs. (E) Schematics of structure of p44. WD40-1 and WD40-2 are atypical WD40 repeats. NLS1 is dominant while NLS2 and NLS3 are atypical NLS. NES1 is dominant but NES2 is atypical NES. AID: AR Interaction Domain. TAD: Transcriptional Activation Domain. GSD: Growth Suppression Domain.

Journal: PLoS ONE

Article Title: Functional Domains of Androgen Receptor Coactivator p44/Mep50/WDR77and Its Interaction with Smad1

doi: 10.1371/journal.pone.0064663

Figure Lengend Snippet: (A) Upper panel: Proliferation of cells stably expressing truncated N-terminal p44 in LNCaP cells. Truncated NLS-N8 showed significantly inhibitory effects on cell proliferation in LNCaP cells (p = 0.02). Lower panel: RT-PCR for expression of truncated constructs. (B) Upper panel: Proliferation of cells stably expressing truncated C-terminal p44 in LNCaP cells. Truncated NLS-C8 and NLS-C6 (p<0.05) displayed inhibitory effects on cell proliferation in LNCaP cells. Lower panel: RT-PCR for expression of truncated constructs. (C) Upper panel: Proliferation of cells stably expressing truncated N-terminal p44 in LNCaP-AI cells. Truncated NLS-N8 and NLS-N6 (p = 0.04) showed significant inhibitory effects on cell proliferation in LNCaP-AI cells. Lower panel: RT-PCR for expression of truncated constructs. (D) Upper panel: Proliferation of cells stably expressing truncated C-terminal p44 in LNCaP-AI cells. Truncated NLS-C8 and NLS-C6 (p = 0.035) displayed significant inhibitory effects on cell proliferation in LNCaP cells. Lower panel: RT-PCR for expression of truncated constructs. (E) Schematics of structure of p44. WD40-1 and WD40-2 are atypical WD40 repeats. NLS1 is dominant while NLS2 and NLS3 are atypical NLS. NES1 is dominant but NES2 is atypical NES. AID: AR Interaction Domain. TAD: Transcriptional Activation Domain. GSD: Growth Suppression Domain.

Article Snippet: Briefly, to screen p44 interacting protein, yeast strain EGY48 ( MATa leu2::6xLexAop-LEU2 trp ura ade his ) was transformed with pSH18-34 reporter vector [URA3, 2 μ, 8xLexAop::lacZ] (Origene Technologies), pLexA or pLexA::p44.

Techniques: Stable Transfection, Expressing, Reverse Transcription Polymerase Chain Reaction, Construct, Activation Assay